View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8889_low_167 (Length: 221)
Name: NF8889_low_167
Description: NF8889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8889_low_167 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 2386427 - 2386226
Alignment:
| Q |
1 |
atttctttcattatctctctatttaatctcattaggccaaggtggatataatccatctctacaagcctttggagctgatcaacttggtgaagatgaagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2386427 |
atttctttcattatctctctatttaatctcattaggccaaggtggatataatccatctctacaagcctttggagctgatcaacttggtgaagatgaagaa |
2386328 |
T |
|
| Q |
101 |
ctaccttgtagtaacacagatgatacaagtagcaacaaaaaagcacttttctttcaatggtggtattttggtgtttgtgctggaagcctaatgggtgtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2386327 |
ctaccttgtagtaacacagatgatacaagtagcaacaaaaaagcacttttctttcaatggtggtattttggtgtttgtgctggaagcctaatgggtgtaa |
2386228 |
T |
|
| Q |
201 |
ca |
202 |
Q |
| |
|
|| |
|
|
| T |
2386227 |
ca |
2386226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University