View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8889_low_175 (Length: 202)
Name: NF8889_low_175
Description: NF8889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8889_low_175 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 33 - 171
Target Start/End: Complemental strand, 39419905 - 39419767
Alignment:
| Q |
33 |
catacccatgccttcccactccatcgccaccaccctcacttcgccactcacaactacagagatgctctcaccaaatccattctcttctttgaaggccaaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39419905 |
catacccatgccttcccactccatcgccaccaccctcacttcgccactcacaactacagagatgctctcaccaaatccattctcttctttgaaggccaaa |
39419806 |
T |
 |
| Q |
133 |
gatcagggaagctcccttctaaccagagaatgtcttgga |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39419805 |
gatcagggaagctcccttctaaccagagaatgtcttgga |
39419767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University