View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8889_low_81 (Length: 328)

Name: NF8889_low_81
Description: NF8889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8889_low_81
NF8889_low_81
[»] chr3 (1 HSPs)
chr3 (246-292)||(8521829-8521875)


Alignment Details
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 246 - 292
Target Start/End: Original strand, 8521829 - 8521875
Alignment:
246 agattcttataaaattgtaaaatttcttgtaaaatgggtaaatgatc 292  Q
    |||||||||||||||||||||||||||||||||||  ||||||||||    
8521829 agattcttataaaattgtaaaatttcttgtaaaatctgtaaatgatc 8521875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University