View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8890_high_27 (Length: 248)
Name: NF8890_high_27
Description: NF8890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8890_high_27 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 99 - 248
Target Start/End: Original strand, 52182956 - 52183105
Alignment:
| Q |
99 |
tatggttttatttgcaggtaatgtagcttcggggacaatgtttaccatagaaaaccgttgcaacaacacaatctggccgggaacactttctggcaaccgt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52182956 |
tatggttttatttgcaggtaatgtagcttcggggacaatgtttaccatagaaaaccgttgcaacaacacaatctggccgggaacactttctggcaacggt |
52183055 |
T |
|
| Q |
199 |
gctgaacttctcggcgacgggggattttctctgccgcaaggatcgtcttt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52183056 |
gctgaacttctcggcgacgggggattttctctgccgccaggatcgtcttt |
52183105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 18 - 64
Target Start/End: Original strand, 52182881 - 52182927
Alignment:
| Q |
18 |
tctactaggtgaacaagaaatttaacactgattttacgttccatgtc |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52182881 |
tctactaggtgaacaagaaatttaacactgattttacgttccatgtc |
52182927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University