View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8890_low_40 (Length: 400)
Name: NF8890_low_40
Description: NF8890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8890_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 378; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 378; E-Value: 0
Query Start/End: Original strand, 1 - 390
Target Start/End: Original strand, 2195876 - 2196265
Alignment:
| Q |
1 |
aggttcaccaaaccaggtacttgtaattgttgcttaagctcgataaacttctcttcatgagattcagaatatttcacaaacttcacacactcacgaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2195876 |
aggttcaccaaaccaggtacttgtaattgttgcttaagctcgataaacttctcttcatgagattcagaatatttcacaaacttcacacactcacgaactt |
2195975 |
T |
 |
| Q |
101 |
tgctaatagttttgctcattgcccgtagcacatctactgcaaggcgactgagaacacgggcatagcaattctggtttaataactgaccactgagaatcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2195976 |
tgctaatagttttgctcattgcccgtagcacatctactgcaaggcggctgagaacacgggcatagcaattctggtttaataactgaccactgagaatcac |
2196075 |
T |
 |
| Q |
201 |
agggttattaacagatagattgcctcgtaaatttaccttcacagtctcactcgagaaagatttatcaagagcaagggtaagtacccgaccctccaaatgc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2196076 |
agggttattaacagatagattgcctcgtaaatttaccttcacagtctcacttgagaaagatttatcaagtgcaagggtaagtacccgaccctccaaatgc |
2196175 |
T |
 |
| Q |
301 |
caatcagatatgcaggtcattatggtttggtttagggaatcacctgaatcaggaaatggtactttaacaacattgagaataggatgatgt |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2196176 |
caatcagatatgcaggtcattatggtttggtttagggaatcacctgaatcaggaaatggtactttaacaacattgagaataggatgatgt |
2196265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 132 - 211
Target Start/End: Complemental strand, 44844613 - 44844534
Alignment:
| Q |
132 |
atctactgcaaggcgactgagaacacgggcatagcaattctggtttaataactgaccactgagaatcacagggttattaa |
211 |
Q |
| |
|
||||| |||||||| |||||| ||||| ||||| ||| |||| ||||||| |||||| |||| ||||||||||| |||| |
|
|
| T |
44844613 |
atctaatgcaaggcaactgagcacacgagcataacaactctgtcttaataattgaccattgaggatcacagggttcttaa |
44844534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University