View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8890_low_42 (Length: 377)
Name: NF8890_low_42
Description: NF8890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8890_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 35 - 363
Target Start/End: Complemental strand, 9222769 - 9222438
Alignment:
| Q |
35 |
ctgaaatatatttttacctgggaagaattttccgataatgcggaggatcttgcggccatgcttatctctgcctttgatcttgaagacttccaatttctca |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9222769 |
ctgaaatatatttttacctgggaagaattttccgataatgcggaggatcttgcggccatgcttatctctgcctttgatcttgaagacttccaatttctca |
9222670 |
T |
 |
| Q |
135 |
agcaattcttcttgttcaagttcagttatggtggtgctcatgnnnnnnnnn---ggcgtagtgatagaagaaaaaggtgtgattgtgaatcgaatcgtga |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9222669 |
agcaattcttcttgttcaagttcagttatggtggtgctcatgtttttttttattggcgtagtgatagaagaaaaaggtgtgattgtgaatcgaatcgtga |
9222570 |
T |
 |
| Q |
232 |
tgattatgattgtgatggtggatttggattgatagggattataatttataaggagttatgcaattaacgtaatgaatgggttaattaaataaaacagaaa |
331 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9222569 |
tgattatgattgtgatggtggatttggatggatagggattataatttataaggagttatgcaattaacgtaatgaatgggttaattaaataaaacagaaa |
9222470 |
T |
 |
| Q |
332 |
attaatttgagattaagataacgaaaaaggaa |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9222469 |
attaatttgagattaagataacgaaaaaggaa |
9222438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 95 - 176
Target Start/End: Complemental strand, 51685013 - 51684932
Alignment:
| Q |
95 |
cttatctctgcctttgatcttgaagacttccaatttctcaagcaattcttcttgttcaagttcagttatggtggtgctcatg |
176 |
Q |
| |
|
|||||||||| ||||||| |||||||||| ||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51685013 |
cttatctctgtctttgattttgaagacttttaatttctcaagaaattcttcttgttcaagttcagttacagtggtgctcatg |
51684932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University