View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8890_low_64 (Length: 302)
Name: NF8890_low_64
Description: NF8890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8890_low_64 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 5 - 302
Target Start/End: Original strand, 51000790 - 51001075
Alignment:
| Q |
5 |
ggataaaatagcaattaacaacgtaagaaccatgctgaatattctttgtaaaaatt-caatgatataaa-cccttgatcctaaacacgggattacaaaaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51000790 |
ggataaaatagcaattaacaacgtaagaaccatgctgaatattctttgtaaaaattacaatgatataaaacccttgatcctaaacacgggattacaaaaa |
51000889 |
T |
 |
| Q |
103 |
ctcactcatcaagcatccgataaactctcctccgaaagtttgcattgtcctcaccacgagcatagaagcaatgcaagactggaacactaccatcctacat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51000890 |
ctcactcatcaagcatccgataaactctcctccgaaagtttgcattgtcctcaccacgagcatagaagcaatgcaagactgcaacactaccatcctacat |
51000989 |
T |
 |
| Q |
203 |
tgaacaatagaaccaataagttaggcaactcatgagaccaaagtagaatgcaaactaagggagaaaaatggcaccagacaacatacagatattaaaaaca |
302 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51000990 |
tgaacaatagaaccaataa--------------gagaccaaagtaaaatgcaaattaagggagaaaaatggcaccagacaacatacagatattaaaaaca |
51001075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University