View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8890_low_79 (Length: 263)
Name: NF8890_low_79
Description: NF8890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8890_low_79 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 10296287 - 10296542
Alignment:
| Q |
1 |
tatgtttacatcttcgcataagaaaactacatttggttactgttttctcatttaattattttctggttattcagttctatgtctgtgctttagaat--ga |
98 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
10296287 |
tatgtttacctcttcgcataagaaaactacatttggttactgttttctcatttaattattttcttgttattcagttctatgtctgtgctttagaatatga |
10296386 |
T |
|
| Q |
99 |
cactactttgattgggagagttaaagtgataaagtatgctactgaaaggacacgtttcatcataaaatctttgacagcacattgttctagaattgcagtt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10296387 |
cactactttgattgggagagttaaagtgataaagtatgctactgaaaggacacgtttcatcataaaatctttgacagcacattgttctagaattgcagtt |
10296486 |
T |
|
| Q |
199 |
ggtgatggtcgtgatggtatcattttcttttcatacgacgaggtgagtgttgatgt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10296487 |
ggtgatggtcgtgatggtatcattttcttttcttacgacgaggtgagtgttgatgt |
10296542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 160 - 253
Target Start/End: Complemental strand, 43795367 - 43795274
Alignment:
| Q |
160 |
ataaaatctttgacagcacattgttctagaattgcagttggtgatggtcgtgatggtatcattttcttttcatacgacgaggtgagtgttgatg |
253 |
Q |
| |
|
|||| ||||||||| ||| ||| | ||||||||||||||| ||| ||||||||||||| |||||||||| ||| | |||||||||| ||||| |
|
|
| T |
43795367 |
ataagatctttgactgcatattttagtagaattgcagttggagataatcgtgatggtatccttttcttttcttaccatgaggtgagtggtgatg |
43795274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University