View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8890_low_8 (Length: 666)
Name: NF8890_low_8
Description: NF8890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8890_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 383; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 15 - 465
Target Start/End: Original strand, 42812364 - 42812809
Alignment:
| Q |
15 |
gacatcaggaatatgagcaattaaaccatcagagaaaccatgaccttgatgatcaatagcgcaagtggcgaatccggctttagcaaagtagacggcggag |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42812364 |
gacatcaggaatatgagcaattaaaccatcagagaaaccatgaccttgatgatcaatggcgcaagtggcgaatccggctttagcaaagtagacggcggag |
42812463 |
T |
|
| Q |
115 |
agttggacagtccagctggattcgccggtgtagccgtggacgacggcgagggttccgataagtttagttggaggattagggatccaccactgagtgaaga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42812464 |
agttggacagtccagctggattcgccggtgtagccgtggacgacggcgagggttccgatgagtttggttggaggattagggatccaccactgagtgaaga |
42812563 |
T |
|
| Q |
215 |
gtttgagacctcttgagttggttatgaactcggaggtgtgagtcactgagtggcgagtgtagaattcttcaggagttagggttccgaaggggctatgatc |
314 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42812564 |
gtttaagacctcttgagttggttatgaactcggaggcgtgagtcactgagtggcgagtgtagaattcttcaggagttagggttccgaaggggctatgatc |
42812663 |
T |
|
| Q |
315 |
gttggcttctgctactgggtgcaccattttggatatcttctactatcagttagttatgtgtggatatagttatagtttgagtttcggctataatcagcgt |
414 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| | ||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42812664 |
gttggcttctgctattgggtgcaccattttggatattaac-----tcactcagttatgtgtggatatagttatagtttgagtttcggctataatcagcgt |
42812758 |
T |
|
| Q |
415 |
gtcccaactagttcttccacttttctccccttcatttacttctctacttgc |
465 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42812759 |
gtcccaactagttcttcgacttttctccccttcatttacttctctacttgc |
42812809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University