View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8890_low_81 (Length: 255)
Name: NF8890_low_81
Description: NF8890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8890_low_81 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 244
Target Start/End: Complemental strand, 498694 - 498453
Alignment:
| Q |
17 |
aatgttggcatatgtgctccacatcatagctacgttaataatgataatgggaagagtttggttgagtt-------------atgctctcggtgaag-cgt |
102 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| ||| |
|
|
| T |
498694 |
aatgttggcatatttgctccacatcatagctacgttaataatgataatgggaagagttttgttgagttgttctcttgagttatgctctcggtgaagtcgt |
498595 |
T |
 |
| Q |
103 |
agcgaatcatgctcctaaatgaaaattgaaatgatgataagaaagagtgtatgatcttattgtttttgctttgttatctttatcactactgtcaatggca |
202 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
498594 |
agcgaatcatgctcctatatgaaaattgaaatgatgataagaaagagtgcatgatcttattgtttttgctttgttatctttatcactactgtcaatggca |
498495 |
T |
 |
| Q |
203 |
aagcttctttaaggtcaaagtgaaccacggcctaacaccaaa |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
498494 |
aagcttctttaaggtcaaagtgaaccacgacctaacaccaaa |
498453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University