View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8890_low_89 (Length: 246)
Name: NF8890_low_89
Description: NF8890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8890_low_89 |
 |  |
|
| [»] scaffold0189 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0189 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 95 - 234
Target Start/End: Original strand, 30636 - 30775
Alignment:
| Q |
95 |
acttgaaaattacttgggtgtcttttggtttttgtgtgtaaatagtagtagagctggaaataaacacataggtggtgtttgtattttatagttcaaataa |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30636 |
acttgaaaattacttgggtgtcttttggtttttgtgtttaaatagtagtagagctggaaataaacacataggtggtgtttgtattttatagttcaaataa |
30735 |
T |
 |
| Q |
195 |
cacaactgcatgtgtgttaattacaggtgtattttgatgt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30736 |
cacaactgcatgtgtgttaattacaggtgtattttgatgt |
30775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University