View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8890_low_96 (Length: 239)
Name: NF8890_low_96
Description: NF8890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8890_low_96 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 4048472 - 4048565
Alignment:
| Q |
1 |
gagtagccccatcaccaaagaatctgtcggcagcagagacgtcacgctgttctttcttacattattacccacacgcaaacatcaacaacacttt |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4048472 |
gagtagccccatcaccaaagaatctgtcggcagcagagacgtcacgctgttctttcttacattattacccacacgctaacatcaacaacacttt |
4048565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 156 - 236
Target Start/End: Original strand, 4048627 - 4048707
Alignment:
| Q |
156 |
gaatagtgttggtctttctttctttagttgttctccgtctacctctcgtcgttgtcgatgttgttgtttgttgatgtccat |
236 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
4048627 |
gaatagtgttggtctttctttcattagttgttctccgtctacctctcgtcgttgtcgatgttgttgtttgtcgttgtccat |
4048707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University