View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8891_high_16 (Length: 241)
Name: NF8891_high_16
Description: NF8891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8891_high_16 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 6 - 241
Target Start/End: Original strand, 27584209 - 27584444
Alignment:
| Q |
6 |
gatggacatcagatacatgttatgaacttcttccctgtgttttatgttgcctctgacaatattttgcttaatgacggacaggaccgtgcttctgaaaacg |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27584209 |
gatggacatgagatacatgttatgaacttcttccctgtgttttatgttgcctctgacaatattttgcttaatgacggacaggaccgtgcttctgaaaacg |
27584308 |
T |
|
| Q |
106 |
aggagttgaaatctcaaattgaagaggcctatatgttagtggaaaaattgatggctgaaaatgctgaacttgttgagaaggtaaatatgcagggttcttg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27584309 |
aggagttgaaatctcaaattgaagaggcctatatgttagtggaaaaattgatggctgaaaatgctgaacttgttgagaaggtaaatatgcagggttcttg |
27584408 |
T |
|
| Q |
206 |
atggttttgtaatgacagtttttattattttatttt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27584409 |
atggttttgtaatgacagtttttattattttatttt |
27584444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University