View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8891_low_17 (Length: 395)
Name: NF8891_low_17
Description: NF8891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8891_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 15 - 382
Target Start/End: Complemental strand, 46752332 - 46751962
Alignment:
| Q |
15 |
agagaggagtatcgagtgttcattattattggagcactgaaaatttgttcaaataaggcaagcatgggggccataggtttagcaaggctctccaccactg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752332 |
agagaggagtatcgagtgttcattattattggagcactgaaaatttgttcaaataaggcaagcatgggggccataggtttagcaaggctctccaccactg |
46752233 |
T |
 |
| Q |
115 |
actttggattttagatgtctttttctaaagaaatcttatttcatgagattagtctccatagttaaatgtgcagattaattaagttataataatgatttcg |
214 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46752232 |
actttggattttagatgtcttgttataaagaaatcttgtttcatgagattagtctccatagttaaatgtgcagattaattaagttataataatcatttcg |
46752133 |
T |
 |
| Q |
215 |
gttaaaaattgaagtcgtgactagatgctgcttaacacat-cccatcccacatctaataatctgtcaatactacgttggt----gaaacataagtgatat |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46752132 |
gttaaaaattgaagtcgtgactagatgctgcttaacacatacacatcccacatctaataatctgtcaatactacgttggtgaaagaaacataagtgatat |
46752033 |
T |
 |
| Q |
310 |
gaatatgttttgcttttgcttttgctttcagtaggaattttataacgtttatgcgtcgttgaatgtgggtttt |
382 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752032 |
ga--atgttttgcttttgcttttgctttcagtaggaattttataacgtttatgcgtcgttgaatgtgggtttt |
46751962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University