View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8891_low_57 (Length: 207)

Name: NF8891_low_57
Description: NF8891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8891_low_57
NF8891_low_57
[»] chr2 (1 HSPs)
chr2 (91-207)||(37968202-37968318)


Alignment Details
Target: chr2 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 91 - 207
Target Start/End: Complemental strand, 37968318 - 37968202
Alignment:
91 gcagttgcagcaattgtggtctaataagagctatctatgttgtgccccaagcaattacagttcaaagtcacggcctgattcgatagcagcaaccacagaa 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
37968318 gcagttgcagcaattgtggtctaataagagctatctatgttgtgccccaagcaattacagttcacagtcacggcctgattcgatagcagcaaccacagaa 37968219  T
191 atcgagccactaccttc 207  Q
    ||||||||||| |||||    
37968218 atcgagccactgccttc 37968202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University