View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8891_low_58 (Length: 207)
Name: NF8891_low_58
Description: NF8891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8891_low_58 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 91 - 207
Target Start/End: Complemental strand, 37968318 - 37968202
Alignment:
| Q |
91 |
gcagttgcagcaattgtggtctaataagagctatctatgttgtgccccaagcaattacagttcaaagtcacggcctgattcgatagcagcaaccacagaa |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37968318 |
gcagttgcagcaattgtggtctaataagagctatctatgttgtgccccaagcaattacagttcacagtcacggcctgattcgatagcagcaaccacagaa |
37968219 |
T |
 |
| Q |
191 |
atcgagccactaccttc |
207 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
37968218 |
atcgagccactgccttc |
37968202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University