View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8893_high_24 (Length: 253)
Name: NF8893_high_24
Description: NF8893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8893_high_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 22866686 - 22866450
Alignment:
| Q |
17 |
atcataatattatttggtcatgtagctggtttcatcaatatgggtgaaaatgtctttggttgttctatttttgaacttttgaatgattcaaatatcacct |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
22866686 |
atcataatattatttggtcacgtagctggtttcatcaatatgggtgaaaatgtctttggttgttctattttagaacttttgaataattcaaatatcacct |
22866587 |
T |
 |
| Q |
117 |
tgattgtgtactttaaattttagaccatgcgttcataagtatgtcatatgatttccaattctacacatttgaatcttgacaattgcttcttagctatgtt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22866586 |
tgattgtgtactttaaattttagaccatgcgttcataagtatgtcatatgatttccaattctacacatttgaatcttgacaattgcttcttagctatgtt |
22866487 |
T |
 |
| Q |
217 |
gttaatcgcggatagcaatagctgctgctgtaaagac |
253 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22866486 |
gttaatcgcggatagcaatagcttctgctgtaaagac |
22866450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University