View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8893_low_32 (Length: 432)
Name: NF8893_low_32
Description: NF8893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8893_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 28 - 304
Target Start/End: Complemental strand, 21012439 - 21012164
Alignment:
| Q |
28 |
taatatttttccaataagaattttctgaaatcgcctatggacataattcaggttattttctgtagagtgtatgtttggtttaacctaggaacgtttttag |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21012439 |
taatatttttccaataagaattttctgaaatcgcctatggacataattcaggttattttctgtaaagtgtatgtttggtttaacctaggaacgtttttag |
21012340 |
T |
|
| Q |
128 |
atcaaaatgacattgtattccctataatattgaaaacgatgttgtagtatatataaaaataactttgggtggatgcagtttacgacggtctaaatccttt |
227 |
Q |
| |
|
||||||||| | |||||| |||||||||||||||||||||||||| |||| |||||||||||||||| ||| ||||||| ||||||||| |||| |||| |
|
|
| T |
21012339 |
atcaaaatggtactgtatttcctataatattgaaaacgatgttgtattata-ataaaaataactttggatgggtgcagttcacgacggtccaaattcttt |
21012241 |
T |
|
| Q |
228 |
catccagtctgacccacacttgtccaccgagaatgaaat-gaccacatgccctaacttgtctaactgtttgattcaac |
304 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||| | |||| || || |||| |||||||||||||||||||| |
|
|
| T |
21012240 |
catccggtctgacccacacttgtccaccgagaatggaatgggccacctg-ccaaactcgtctaactgtttgattcaac |
21012164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 330 - 368
Target Start/End: Complemental strand, 21012137 - 21012099
Alignment:
| Q |
330 |
gaatggttgggccgggttcgacccacatgtccacccttg |
368 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21012137 |
gaatggttgggtcgggttcgacccacatgtccacccttg |
21012099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University