View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8893_low_79 (Length: 229)
Name: NF8893_low_79
Description: NF8893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8893_low_79 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 81 - 229
Target Start/End: Complemental strand, 22866358 - 22866210
Alignment:
| Q |
81 |
tcacctttgctccccaaggatcgcgattgtgcgattttggctcgtcannnnnnn-ggagcgatcttggcccttcatgttttcctcctttgatttggcagt |
179 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22866358 |
tcacttttgctccccaaggatcgcgattgtgcgattttggctcgtcattatttttggagcgatcttggcccttcatgttttcctcctttgatttggcagt |
22866259 |
T |
|
| Q |
180 |
cccctcccaatttccccccaaagtttatgtcaaggaacatcacttattga |
229 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22866258 |
cccctcccaatttccccccaaa-tttatgtcaaggaacatcacttattga |
22866210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 22866450 - 22866401
Alignment:
| Q |
1 |
ctaaaaacaacgtacaaaatacctaaattccaataggagacatagacact |
50 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| ||||||||||| |
|
|
| T |
22866450 |
ctaaaaacaacgtacaaactacttaaattccaataggatacatagacact |
22866401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University