View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8895_low_14 (Length: 343)
Name: NF8895_low_14
Description: NF8895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8895_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 5 - 202
Target Start/End: Complemental strand, 10294153 - 10293956
Alignment:
| Q |
5 |
tccccagtatctacacaaaagatcatcctaggaacttcattattgccatgttcccaactccaggagcatatatacttgcgacccaaattagtatcaccat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10294153 |
tccccagtatctacacaaaagatcatcctaggaacttcattattgccatgttcccaactccaagagcatatatacttgcgacccaaattagtatcaccat |
10294054 |
T |
|
| Q |
105 |
tgtcatcgtctttacgcacaggatcataattagccgcctgtcacaaaaaacatgcagcaacatgatagataataagcttttagttcaattcattgtgt |
202 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10294053 |
tgtcatcgtctttacgcacaggatgataattagccgcctgtcacaaaaaacatgcagcaacatgatagataataagcctttagttcaattcattgtgt |
10293956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 252 - 328
Target Start/End: Complemental strand, 10293906 - 10293830
Alignment:
| Q |
252 |
aaccaaggcttgtgagagaaaggtattctcaaaatcatcttatcattgaattcatagttcgactcattgatcagagt |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10293906 |
aaccaaggcttgtgagagaaaggtattctcaaaatcatcttatcattgaattcatagttcgactcattgatcagagt |
10293830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 43799140 - 43799266
Alignment:
| Q |
8 |
ccagtatctacacaaaagatcatcctaggaacttcattattgccatgttcccaactccaggagcatatatacttgcgacccaaattagtatcaccattgt |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||| || ||||||||||||| |||||||| ||||| |||| |||||||| ||||| ||| |
|
|
| T |
43799140 |
ccagtgtctacacaaaagatcatcctaggaacttcataattttcaggttcccaactccaagagcatatgtacttcggaccagaattagtaccaccactgt |
43799239 |
T |
|
| Q |
108 |
catcgtctttacgcacaggatcataat |
134 |
Q |
| |
|
|| |||| | | || ||||||||||| |
|
|
| T |
43799240 |
cactgtctatgcacataggatcataat |
43799266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University