View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8895_low_19 (Length: 297)
Name: NF8895_low_19
Description: NF8895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8895_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 9 - 280
Target Start/End: Complemental strand, 42062345 - 42062072
Alignment:
| Q |
9 |
tggtggttggcatgtgattgtaaattttactaatgttcaaggataaaatgcagtgagatggtaatcatttataatagcactcttccaaatttctgtttgg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42062345 |
tggtggttggcatgtgattgtaaattttactaatgttcaaagataaaatgcagtgagatggtaatcatttataatagcactcttccaaatttctgtttgg |
42062246 |
T |
|
| Q |
109 |
catggtgatctcaatatatatat--tatttggtacaaggtgttctcatttctttatcatataattattgacttaattggaaattctgttttgaagggggc |
206 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42062245 |
catggtgttctcaatatatatatattatttggtacaaggtgttctcatttctttatcatataattattgacttaattggaaattctgttttgaagggggc |
42062146 |
T |
|
| Q |
207 |
acataatacaaatatcatcatatatgtacaaagttcttgtctttgtttgccatttaaatattatatattttttg |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42062145 |
acataatacaaatatcatcatatatgtacaaagttcttgtctttgtttgccatttaaatattatatattttttg |
42062072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University