View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8895_low_23 (Length: 276)
Name: NF8895_low_23
Description: NF8895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8895_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 5 - 157
Target Start/End: Original strand, 54552793 - 54552945
Alignment:
| Q |
5 |
atggacatcaacaaacatatgttttgatacaaagaggaccaacaggaagggttgaatccttcgtaaagatgcaacgagggatgatgttgagtgagaattc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54552793 |
atggacatcaacaaacatatgttttgatacaaagaggaccaacaggaagggttgaatccttcgtaaagatgcaacgagggatgatgttgagtgagaattc |
54552892 |
T |
 |
| Q |
105 |
atagtttattaaatcaggtattgcatcagttctcaaaatggaatggctggtcg |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54552893 |
atagtttattaaatcaggtattgcatcagttctcaaaatggaatggctggtcg |
54552945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 189 - 275
Target Start/End: Original strand, 54552977 - 54553063
Alignment:
| Q |
189 |
gaataaataagggaaatccagaaatacctgtgaacaataggtggaatacattcatgatgaagatatgatacggtctctgcttctcca |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
54552977 |
gaataaataagggaaatccagaaatacctgtgaacaataggtggaatacattcatgatgaagatatgatacggcctctgctgctcca |
54553063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University