View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8897_high_3 (Length: 325)
Name: NF8897_high_3
Description: NF8897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8897_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 309
Target Start/End: Complemental strand, 36051425 - 36051114
Alignment:
| Q |
1 |
ctaaattgcttgtctcccgtcaggacgatgacgctcctctgttgtacgccatcaaaggaatctgcaattttcagttgaacaacctgaacttccaatttta |
100 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
36051425 |
ctaaatttcttgtctcccgtcatgacgatgacgctcctctgttgtacgccatcaatggaatctgcaatttccagttgaacaacctgaacttccgatttta |
36051326 |
T |
|
| Q |
101 |
gtggggaatccagatcctgttcacccgtaatgaaagctatggaatcaacataatcgtgagtgacggagggcttctcaacaagctttgagcatggtggaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36051325 |
gtggggaatccagatcctgttcacccgtaatgaaagctatggaatcaacataatcgtgagtgatggagggcttctcaacaagctttgagcatggtggaag |
36051226 |
T |
|
| Q |
201 |
atcttgattgtgttcacctggtatgtctagtacgagatcaacaacacaatcggaaactcgggaag---gcttcacctccaactttgaggattcacatgtt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
36051225 |
atcttgattgtgttcacctggtatgtctagtacgagatcaacaacacaatcggaaactcgggaaggctgcttcacctccaactttgaggattcacatgct |
36051126 |
T |
|
| Q |
298 |
tcctccgtttct |
309 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36051125 |
tcctccgtttct |
36051114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University