View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8897_low_12 (Length: 241)
Name: NF8897_low_12
Description: NF8897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8897_low_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 7 - 241
Target Start/End: Complemental strand, 36051623 - 36051389
Alignment:
| Q |
7 |
atggacatcaggtttgttaagttttctgcggtacctgatgacaatttcgtgggtggtgagtatttgtgtaaagtaacatgagcatataatggatcgatac |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36051623 |
atggagatcaggtttgttaagttttctgcggtacctgatgacaatttcatgggtggtgagtatttgtgtaaagtaacaggagcatataatggatcgatac |
36051524 |
T |
 |
| Q |
107 |
ctgcagcaacacttccatcccgcggtttcggcggcggcaacggtggagccaaggcagtgtctagcggttttggagattgtggaccgagagcaggattgct |
206 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36051523 |
ctgcagcaacacttccatccggcggtttcggcggcggcaacggtggagccaaggcagtgtctagcggttttggagattgtggaccgagagcaggattgct |
36051424 |
T |
 |
| Q |
207 |
aaatttcttgtctcccgtcatgacgatgacgctcc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36051423 |
aaatttcttgtctcccgtcatgacgatgacgctcc |
36051389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 143
Target Start/End: Complemental strand, 30453739 - 30453622
Alignment:
| Q |
26 |
agttttctgcggtacctgatgacaatttcgtgggtggtgagtatttgtgtaaagtaacatgagcatataatggatcgatacctgcagcaacacttccatc |
125 |
Q |
| |
|
|||||||||||||||| || ||||| ||||||| | ||| ||||||||||||||||||| |||| |||| |||||||| ||||||||||| ||| |
|
|
| T |
30453739 |
agttttctgcggtaccaaataacaatacagtgggtgtcgggtaactgtgtaaagtaacatgagcgcataaaggattgatacctgtagcaacacttcgatc |
30453640 |
T |
 |
| Q |
126 |
ccgcggtttcggcggcgg |
143 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
30453639 |
tggtggtttcggcggcgg |
30453622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University