View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8897_low_14 (Length: 240)
Name: NF8897_low_14
Description: NF8897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8897_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 29603695 - 29603480
Alignment:
| Q |
18 |
gaaaatgtctctggccctatattctctatttcaatgcattgttccttaatcgtcaatcatgtggataaagcctgttcaagcaacacaaacctcttaatgt |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29603695 |
gaaaatgtctctggctctatattctctatttcaatgcattgttccttaatcgtcaatcatgtggataaagcctgttcaagcaacacaaacctcttaatgt |
29603596 |
T |
|
| Q |
118 |
cgcaaattagtctc--aatccctcaagccgtactaggaattgttcttgttcacttcatatgaatggaatcaattacaatttatggggtcgacctatgaaa |
215 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29603595 |
cgcaaattagtctcaaaatccctcaagccgtactaggaattgttcttgttcacttcatatgaatggaatcaattacaatttatggggtcgacctatgaaa |
29603496 |
T |
|
| Q |
216 |
acaaccttgatgtcca |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
29603495 |
acaaccttgatgtcca |
29603480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University