View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8897_low_15 (Length: 210)
Name: NF8897_low_15
Description: NF8897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8897_low_15 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 210
Target Start/End: Complemental strand, 4553799 - 4553597
Alignment:
| Q |
13 |
acatcaacaacggatcgaaccctattctttgtgggatcgtaaggattacaacttgattgtaccatgtgtttggggagtacacacattcacttaagttaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4553799 |
acatcaacaacggatcgaaccctattctttgtgggatcataaggattacaacttgattgtaccatgtgtttggggagtacacacattcacttaagttaaa |
4553700 |
T |
|
| Q |
113 |
agagaaactctaacactaaagcctatccataatctagtgaccaagtaccaaattggcacc-----atcaacatataaaacatccccgtgagcttagctca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
4553699 |
agagaaactctaacactaaagcctatccataatccagtgaccaagtaccaaattggcaccattaaatcaacatatataacatccccgtgagcttaactca |
4553600 |
T |
|
| Q |
208 |
gtt |
210 |
Q |
| |
|
||| |
|
|
| T |
4553599 |
gtt |
4553597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 210
Target Start/End: Original strand, 8865845 - 8865873
Alignment:
| Q |
182 |
taaaacatccccgtgagcttagctcagtt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8865845 |
taaaacatccccgtgagcttagctcagtt |
8865873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 210
Target Start/End: Complemental strand, 9459132 - 9459102
Alignment:
| Q |
180 |
tataaaacatccccgtgagcttagctcagtt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9459132 |
tataaaacatccccgtgagcttagctcagtt |
9459102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University