View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8897_low_5 (Length: 354)
Name: NF8897_low_5
Description: NF8897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8897_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 20 - 335
Target Start/End: Complemental strand, 25991019 - 25990704
Alignment:
| Q |
20 |
agagagaaccaacctgcatttagagagcctcgcaactcttgcaaacatgtacaaaagcccttggttttcggcagtaaaacatttttcagaatcggtaacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25991019 |
agagagaaccaacctgcatttagagagcctcgcaactcttgcaaacatgtacaaaagcccttggttttcggcagtaaaacatttttcagaatcggtaacc |
25990920 |
T |
 |
| Q |
120 |
cgtgttcagccgcatatttttgacttcgaaggcatttctgctcactacaagaagaaaatgatagatgactagaaatcatcaaaaggaaatacacaaacag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25990919 |
cgtgttcagccgcatatttttgacttcgaaggcacttctgctcactacaagaagaaaatgatagatgactagaaatcatcaaaaggaaatacacaaacag |
25990820 |
T |
 |
| Q |
220 |
aaaaggttacatatgctacatcaaatcgaactgaggataaagaaatttgtgcgacaaagtcaccatttgaagtatgggtgatagtatgttcttttacatc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25990819 |
aaaaggttacatatgctacatcaaatcgaactgaggataaagaaatttgtgcgacaaagtcaccatttgaagtatgggtgatagtatgttcttttacatc |
25990720 |
T |
 |
| Q |
320 |
atattaacatttccct |
335 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
25990719 |
atattaacatttccct |
25990704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University