View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8899_low_102 (Length: 223)
Name: NF8899_low_102
Description: NF8899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8899_low_102 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 8 - 208
Target Start/End: Original strand, 34446945 - 34447145
Alignment:
| Q |
8 |
tggacatcaccagcaacttggaagtagtcattggaaggggaggatttggaagtgtttacagtggtcagatgaaagatggcaataaagttgcagtcaagat |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34446945 |
tggacatcaccagcaacttggaaatagtcattggaaggggaggatttggaagtgtttacagtggtcagatgaaagatggcaataaagttgcagtcaagat |
34447044 |
T |
 |
| Q |
108 |
gctttctgcatcttcagctcaaggggcaaaggaatttcaaactgaggtaattagtgttgttggacacaatatacattcagtgatcactctattcaatatt |
207 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34447045 |
gctttctgcatcttcagctcaagggccaaaggaatttcaaactgaggtaattagtgttgttggacacaatatacattcagtgatcactctattcaatatt |
34447144 |
T |
 |
| Q |
208 |
a |
208 |
Q |
| |
|
| |
|
|
| T |
34447145 |
a |
34447145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University