View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8899_low_46 (Length: 401)
Name: NF8899_low_46
Description: NF8899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8899_low_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 15 - 377
Target Start/End: Complemental strand, 34066173 - 34065811
Alignment:
| Q |
15 |
aactaggacagatctatcattttacaatgttaattttgattgaaaacaagtaaatttggtcacttcaacactgttaacactctctgtccgattttattct |
114 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34066173 |
aactaggacagatctatcactttacaatgttaattttgattgaaaacaagtaaatttggtcacttcaacactgttaacactctctgtccgattttattct |
34066074 |
T |
|
| Q |
115 |
gtttatccgatttcaggataacattcctgaccataatcgggtggttttaaataatgatgagttacttactgttaactaggtaagtgcaactaaaagacca |
214 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34066073 |
gtttatcagatttcaggataacattcctgaccataatcgggtggttttaaataatgatgagttacttactgttaactaggtaagtgcaactaaaggacca |
34065974 |
T |
|
| Q |
215 |
ttatctatttgctttatacaatcagaatgatgtagctcaagaagctttgatgggaaggatatatagggctgattacttggacaagcaaggaagggttgtt |
314 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34065973 |
ttatctatttgctttatacaatcaggatgatgtagctcaagaagctttgatgggaaggatatatagggctgattacttggacaagcaaggaagggttgtt |
34065874 |
T |
|
| Q |
315 |
tttgttattaaagctggacgtcaggtaatccaaacacttcgacgggaattaacttaaatttca |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34065873 |
tttgttattaaagctggacgtcaggtaatccaaacacttcgatgggaattaacttaaatttca |
34065811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University