View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8899_low_87 (Length: 275)
Name: NF8899_low_87
Description: NF8899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8899_low_87 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 13 - 275
Target Start/End: Original strand, 16343001 - 16343263
Alignment:
| Q |
13 |
gacatcattttaggacggttgagtgttgggg-cgattttgctgggtaatcaagaattggtaaaagacatataaaatgattgtcaagttttgggtgaaggt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16343001 |
gacatcattttaggacggttgagtgttgggggcgattttgctgggta-tcaagaattggtaaaagacatataaaatgattgtcaagttttgagtgaaggt |
16343099 |
T |
|
| Q |
112 |
tgttttgcgttgaaggnnnnnnnnttaaaagaataaggtgttgccttcgtgattgacataaaaaacatagtcaaagtattgaagaacggtttcaaaattt |
211 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16343100 |
tgttttgcgttgaagg-aaaaaaattaaaagaataaggtgttgccttcgtgattgacacaaaaaacatagtcaaagtattgaagaacggtatcaaaattt |
16343198 |
T |
|
| Q |
212 |
aaattgtttttacgacttttggacagt-nnnnnnnntaggtaagttcatctttagagatcaggtt |
275 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16343199 |
aaattgtttttacgacttctggacagtaaagaaaaataggtaagttcatctttagagatcaggtt |
16343263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University