View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8899_low_95 (Length: 245)
Name: NF8899_low_95
Description: NF8899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8899_low_95 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 149 - 232
Target Start/End: Complemental strand, 7307867 - 7307784
Alignment:
| Q |
149 |
actctgtattgtttcgggtatttggttgcagcaggttctgtattgtgtttctaccaggttcttttttctttctttctgggatct |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7307867 |
actctgtattgtttcgggtatttggttgcagcaggttctgtattgtgtttctaccaggttcttttttcattctttctgggatct |
7307784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 20 - 92
Target Start/End: Complemental strand, 7307996 - 7307924
Alignment:
| Q |
20 |
aaatggtggttgagtaaatcgaagttgtctcattgcctctattatgaatggtgttgggatccttgtatgtgta |
92 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7307996 |
aaatggtgattgagtaaatcgaagttgtctcattgcctctgttatgaatggtgttgggatccttgtatgtgta |
7307924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University