View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8899_low_96 (Length: 245)

Name: NF8899_low_96
Description: NF8899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8899_low_96
NF8899_low_96
[»] chr2 (2 HSPs)
chr2 (149-232)||(7307784-7307867)
chr2 (20-92)||(7307924-7307996)


Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 149 - 232
Target Start/End: Complemental strand, 7307867 - 7307784
Alignment:
149 actctgtattgtttcgggtatttggttgcagcaggttctgtattgtgtttctaccaggttcttttttctttctttctgggatct 232  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
7307867 actctgtattgtttcgggtatttggttgcagcaggttctgtattgtgtttctaccaggttcttttttcattctttctgggatct 7307784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 20 - 92
Target Start/End: Complemental strand, 7307996 - 7307924
Alignment:
20 aaatggtggttgagtaaatcgaagttgtctcattgcctctattatgaatggtgttgggatccttgtatgtgta 92  Q
    |||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
7307996 aaatggtgattgagtaaatcgaagttgtctcattgcctctgttatgaatggtgttgggatccttgtatgtgta 7307924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University