View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8900_high_25 (Length: 267)
Name: NF8900_high_25
Description: NF8900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8900_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 4 - 254
Target Start/End: Complemental strand, 32606931 - 32606681
Alignment:
| Q |
4 |
atgaatacgaaataaaggtttgctctctttcttcttggcatcctaatgtagggagaggctccacattattggttgctttgttcatacacatcatgaacaa |
103 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32606931 |
atgaataagaaataaaggcttgctctctttcttcttggcatcctaatgtagggagaggctccacattattggttgctttgttcatacgcatcatgaacaa |
32606832 |
T |
 |
| Q |
104 |
caaagatcgccctcatttgtctaaaccatctatcccaattcttgccatcaagaatgagaagattagcgtgagaaaaacatttccagccatgattgatcac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32606831 |
caaagatcgccctcatttgtctaaaccatctatcccaattcttgccatcaagaatgagaagattagcgtgagaaaaacatttccagccatgattgatcac |
32606732 |
T |
 |
| Q |
204 |
tgaatctttcacactgcagaaagattaagccccttggatcgtatttgctct |
254 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32606731 |
tgaatctttctcactgcagaaagattaagccccttggatcgtatttgctct |
32606681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 81 - 207
Target Start/End: Original strand, 19543605 - 19543730
Alignment:
| Q |
81 |
ttgttcatacacatcatgaacaacaaagatcgccctcatttgtctaaaccatctatcccaattcttgccatcaagaatgagaagattagcgtgagaa-aa |
179 |
Q |
| |
|
||||||||||||||||| |||| |||||| | || |||||| || || |||| |||||||||||||||| || ||| |||||||||||||| || | |
|
|
| T |
19543605 |
ttgttcatacacatcataaacaccaaaga-caccttcattttcgtacac-atctttcccaattcttgccataaaaaattggaagattagcgtgaaaatta |
19543702 |
T |
 |
| Q |
180 |
acatttccagccatgattgatcactgaa |
207 |
Q |
| |
|
||||| || |||||||||||||||||| |
|
|
| T |
19543703 |
ccattttcaaccatgattgatcactgaa |
19543730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University