View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8900_high_4 (Length: 442)
Name: NF8900_high_4
Description: NF8900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8900_high_4 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 195 - 442
Target Start/End: Original strand, 34361720 - 34361962
Alignment:
| Q |
195 |
acatattgagagtcattattaaccaacgtaacttcattaacaataaatttaaacataattaacattaatttgtgaaccttgaaggctaaataaagatagg |
294 |
Q |
| |
|
|||||| |||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34361720 |
acatatcgagattcattattaaccaacgtaacctcattaacaataaatttaaacataattaacattaatttgtgaaccttgaaggttaaataaagatagg |
34361819 |
T |
 |
| Q |
295 |
gaaatgctttatcaagttgtatttgaatatgtattttgtactctgattagataaaagtacatacaaaactgtctttctcatcctttgaccaagtaaattg |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
34361820 |
gaaatgctttatcaagttgtatttgaatatgtattttgtactctgataagataaaagtacatacaaaactgtctttctcatcctttggccaagt-aattg |
34361918 |
T |
 |
| Q |
395 |
catgttattccttcctgcaacatatcccgcattgacaatgacatgaaa |
442 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34361919 |
catgtta----ttcctgcaacatatcccgcattgacaatgacatgaaa |
34361962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 34361518 - 34361657
Alignment:
| Q |
1 |
tcatgtttagatggattagcttctatctaaaacgcgtgaaaaatgaacatttacactcgcccgtgaaattacgtacgcaaacatcccgtactgaatagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
34361518 |
tcatgtttagatggattagcttctatctgaaacgcgtggaaaatgaacatttacactcgcctgtgaaattccatacgcaaacatcccgtgctgaatagca |
34361617 |
T |
 |
| Q |
101 |
gttctctttaacaagagaaaatggttaattattattcttc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34361618 |
gttctctttaacaagagaaaatggttaattattattcttc |
34361657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University