View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8900_low_21 (Length: 393)
Name: NF8900_low_21
Description: NF8900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8900_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 16 - 376
Target Start/End: Original strand, 6690203 - 6690563
Alignment:
| Q |
16 |
acatcaaatatgccacaatctttttcttttatcacatcaaccacaacgaaaacactttcattcttaaaccttcaaaacacatattaaattggacaccctc |
115 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6690203 |
acatcaaatatgccacagtctttttcttttatcacatcaaccacaacgaaaacactttcattcttaaaccttcaaaacacatattaaatcggacaccctc |
6690302 |
T |
 |
| Q |
116 |
catgctgaacgcgcaagcggaccatcctgtagaatgtcctaaatctaatgaattgggtcagtgcagatcaatatggaccgtcaaaacccgatccaaggac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6690303 |
catgctgaacgcgcaagcggaccatcctgtagaatgtcctaaatctaatgaattgggtcagtgcagatcaatatggaccgtcaaaacccgatccaaggac |
6690402 |
T |
 |
| Q |
216 |
aacacaacataatcagctcacatgtgttcactaaagatagttgctcggataaggacttgaggtctagaatccctatttccttgcaataaaggacaactca |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6690403 |
aacacaacataatcagctcacatgtgttcactaaagatagttgctcggataaggacttgaggtctagaatccctatttccttgcaacaaaggacaactca |
6690502 |
T |
 |
| Q |
316 |
tggtctcattccatgcacacacattttctaccctaaatacctctcaaccttgacgtttact |
376 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6690503 |
tggtctcattccatgcacacacactttctaccctaaatacctctcaaccttgacgtttact |
6690563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University