View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8900_low_22 (Length: 391)
Name: NF8900_low_22
Description: NF8900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8900_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 5e-78; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 222 - 381
Target Start/End: Complemental strand, 29996555 - 29996396
Alignment:
| Q |
222 |
atgatagacataaatacaacaccaaaatttgtataaatatgcagtttctgtagtagcctaggatttctatgctgctatttgttttgattggcacctctgg |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29996555 |
atgatagacataaatacaacaccaaaatttgtataaatatgcagtttctgtagtagcctaggatttctatgctgctatttgttttgattggcacctcttg |
29996456 |
T |
|
| Q |
322 |
agtctcgtgacataaaacggctttatatattctgtagtttctttattctaaaacaccaaa |
381 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29996455 |
agtctcgtgacataaaatggcattatatattctgtagtttctttattctaaaacaccaaa |
29996396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 17 - 125
Target Start/End: Complemental strand, 29996770 - 29996662
Alignment:
| Q |
17 |
agttagtacttattcaatatgtgtctatcatatgatattctatgtcataacctatttcaatttcgatgtggatgtcttagctatttgaattatcaacatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29996770 |
agttagtacttattcaatatgtgtctatcatatgatattctatatcataacctatttcaatttcgatgtggatgtcttagctatttgaattatcaacatt |
29996671 |
T |
|
| Q |
117 |
tattttcaa |
125 |
Q |
| |
|
||||||||| |
|
|
| T |
29996670 |
tattttcaa |
29996662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 177 - 221
Target Start/End: Complemental strand, 29996640 - 29996596
Alignment:
| Q |
177 |
ctcgatttatcttgtacaacttattattaaacctaagagacataa |
221 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29996640 |
ctcgagttatcttgtacaacttattattaaacctaagagatataa |
29996596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University