View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8900_low_47 (Length: 305)
Name: NF8900_low_47
Description: NF8900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8900_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 14 - 287
Target Start/End: Complemental strand, 40264916 - 40264644
Alignment:
| Q |
14 |
cagagacctcccaaaggaccattttatgtttcccgcaaaacgattgatgaacagattgcagatcttacatatttcgcgaggttgctttactgcctagttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40264916 |
cagagacctcccaaaggaccattttatgtttcccgcaaaacgattgatgaacagattgcagatcttacatatttcgcgaggttgctttactgcctagttt |
40264817 |
T |
 |
| Q |
114 |
cttattctgtgttttgttctataagannnnnnncattgactgaactttcttattaggaggtttaagtatgcttctgtgggactcacggtgtttggtgctt |
213 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40264816 |
cttattctgtgttttgttctataagattttttt-attgactgaactttcttattaggaggtttaagtatgcttctgtgggactcacgctgtttggtgctt |
40264718 |
T |
 |
| Q |
214 |
ggctaatagccgaatttgctatttggtgcatcacgaaagacggtgatgctgtgagctgtgaaaaaggtacaatc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40264717 |
ggctaatagccgaatttgctatttggtgcatcacgaaagacggtgatgctgtgagctgtgaaaaaggtacaatc |
40264644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 40283761 - 40283713
Alignment:
| Q |
18 |
gacctcccaaaggaccattttatgtttcccgcaaaacgattgatgaaca |
66 |
Q |
| |
|
||||||||||||| ||||||||||| || ||||| ||||||||||||| |
|
|
| T |
40283761 |
gacctcccaaagggccattttatgtctctagcaaagcgattgatgaaca |
40283713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University