View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8900_low_65 (Length: 238)
Name: NF8900_low_65
Description: NF8900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8900_low_65 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 55123670 - 55123890
Alignment:
| Q |
18 |
agaatatgaaccaatgaaaaacataagcaagaaggggaagaagaagatgagtaattgaaagttgatggcagtgttgtgtaactgagccttgaagtttttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55123670 |
agaatatgaaccaatgaaaaacataagcaagaaggggaagaagaagatgagtaattgaaagttgatggcagtgttgtgtaactgagccttgaagtttttg |
55123769 |
T |
|
| Q |
118 |
tactgagaaaaacataacaagctaatgacgatgccaaataccatgagcaagtggaatgggggtgcagaaacagaagccatgctctttcttctccatccct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
55123770 |
tactgagaaaaacataacaagctaatgacgatgccaaataccatgaacaagtggaatgggggtgcagaaacagaagccatgctctttcctttccatccct |
55123869 |
T |
|
| Q |
218 |
gtttcaattctgtaccccttc |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
55123870 |
gtttcaattctgtaccccttc |
55123890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University