View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8901_high_31 (Length: 319)
Name: NF8901_high_31
Description: NF8901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8901_high_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 5 - 311
Target Start/End: Original strand, 43034656 - 43034962
Alignment:
| Q |
5 |
gagcaatgaagagagtagcatcaggcatgcaagtcacgtgccgtacccccacttgtacaacaggtttacttacttttccttcaccactcacagttgaacc |
104 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43034656 |
gagcaatgaagagagcagcatcaggcatgcaagtcacgtgccgtacccccacttgtacaacaggtttacttacttttccttcaccactcacagttgaacc |
43034755 |
T |
 |
| Q |
105 |
catcacaaacccttcacccggtaaccactttgaacccaatattgcagaatcaatgcagaatttaccaccttttttcacactcactgtgccttcagcaatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43034756 |
catcacaaacccttcacccggtaaccactttgaacccaatattgcagaatcaatgcagaatttaccaccttttttcacactcactgtgccttcagcaatt |
43034855 |
T |
 |
| Q |
205 |
ggttttgcattaacaggtccattgtcagagaaaagctctatcttgtagcccaagccatcgataggacctctctctcaccatgcctcgagacgaccccatg |
304 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
43034856 |
ggtattgcattaacaggtccattgtcagagaaaagctctaccttgtagcccaagccatcgataggacctctctctcgccatgcctcgagatgaccccatg |
43034955 |
T |
 |
| Q |
305 |
atgtcca |
311 |
Q |
| |
|
|| |||| |
|
|
| T |
43034956 |
atttcca |
43034962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University