View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8901_low_142 (Length: 255)
Name: NF8901_low_142
Description: NF8901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8901_low_142 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 7452550 - 7452685
Alignment:
| Q |
1 |
agggagtatgcatcacttgtcacatctaacatatatggttgaagtaaaatgaaacacacacacaatgtcaattcaacatgcttgtctagttgtctaccta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7452550 |
agggagtatgcatcacttgtcacatctaacatatatggttgaagtaaaatgaaacacacacacaatgtcaattcaacatgcttgtctagttgtctaccta |
7452649 |
T |
|
| Q |
101 |
ggaaaagcaagcaatgtaaaacactgattttgatcc |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7452650 |
ggaaaagcaagcaatgtaaaacactgattttgatcc |
7452685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 188 - 239
Target Start/End: Original strand, 7452737 - 7452788
Alignment:
| Q |
188 |
gactagttacatgatataatttagggtcgtcgacaatgagctttgcacatat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7452737 |
gactagttacatgatataatttagggtcgtcgacaatgagctttgcacatat |
7452788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University