View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8901_low_148 (Length: 250)
Name: NF8901_low_148
Description: NF8901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8901_low_148 |
 |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0015 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 7 - 250
Target Start/End: Complemental strand, 178488 - 178245
Alignment:
| Q |
7 |
gcaatgagatggacatctccctttcaaatcggataatttccaccctatcgcttctttgttgaacttgaggatttccaccaactttgcttcttcagtgacg |
106 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
178488 |
gcaataagatggacatatccctttcaaatcggataatttccaccctatcgcttctttgttgaacttgaggatttccaccaactttgcttcttcagtgacg |
178389 |
T |
 |
| Q |
107 |
gacaaggagctactaatgatcaccggtttggtaccaccgtcttcaaggaacacatatttcaaatgtgatggtaaaactttcaattcaaccttggtgtcat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
178388 |
gacaaggagctactaatgatcaccggtttggtaccaccatcttcaaggaacacatatttcacatgtgatggtaaaactttcaattcaaccttggtgtcat |
178289 |
T |
 |
| Q |
207 |
caactttggcttcttccttggagtcctctttcaactcttctagt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
178288 |
caactttggcttcttccttggagtcctctttcaactcttctagt |
178245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 34 - 243
Target Start/End: Complemental strand, 20172083 - 20171874
Alignment:
| Q |
34 |
atcggataatttccaccctatcgcttctttgttgaacttgaggatttccaccaactttgcttcttcagtgacggacaaggagctactaatgatcaccggt |
133 |
Q |
| |
|
|||||| || ||||| ||||| |||||||| || |||||||| ||| ||||| ||| ||| || ||||||||||||||||||||||| | |||||| |
|
|
| T |
20172083 |
atcggacaacttccaacctattgcttctttattactcttgaggacttcgaccaattttttttcctctttgacggacaaggagctactaatgttaaccggt |
20171984 |
T |
 |
| Q |
134 |
ttggtaccaccgtcttcaaggaacacatatttcaaatgtgatggtaaaactttcaattcaaccttggtgtcatcaactttggcttcttccttggagtcct |
233 |
Q |
| |
|
||||||||| | | ||||| || || || ||||| ||||||||||| ||||| | ||||||||||| ||| ||||||||| |||||||||||| || | |
|
|
| T |
20171983 |
ttggtaccatcattttcaaaaaaaacgtacttcaagtgtgatggtaagacttttagttcaaccttggcatcaccaactttggattcttccttggactcat |
20171884 |
T |
 |
| Q |
234 |
ctttcaactc |
243 |
Q |
| |
|
|||||||||| |
|
|
| T |
20171883 |
ctttcaactc |
20171874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 198
Target Start/End: Complemental strand, 17787590 - 17787509
Alignment:
| Q |
117 |
tactaatgatcaccggtttggtaccaccgtcttcaaggaacacatatttcaaatgtgatggtaaaactttcaattcaacctt |
198 |
Q |
| |
|
||||||||||||||||||| || ||| | ||||||||| | |||||||| | |||||| | ||||| |||| ||||||||| |
|
|
| T |
17787590 |
tactaatgatcaccggttttgtgccatcctcttcaaggcatacatattttagatgtgacgacaaaaccttcatttcaacctt |
17787509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University