View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8901_low_151 (Length: 250)
Name: NF8901_low_151
Description: NF8901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8901_low_151 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 18613 - 18853
Alignment:
| Q |
11 |
cagagaactatcatctatcaatgcacggtaaaatcaaaactaaacatccaaaacattggtgtctaaatgaaataactcttgtgatgtttaacactaaaga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18613 |
cagagaactatcatctatcaatgcacggtaaaatcaaaactaaacatccaaaacattggtgtctaaatgaaataactcttgtgatgtttaacactaaaga |
18712 |
T |
 |
| Q |
111 |
cacaataattgactaatagatgtatcaagattcaaaatccttaaaaccccttcattttgtaagatttcaaatcaatc-accccaaatgaaacctagcctt |
209 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18713 |
cacaataattgactaataaatgtatcaagattcaaaatccttaaaaccccttcattttgtaagatttcaaatcaatcaaccccaaatgaaacctagcctt |
18812 |
T |
 |
| Q |
210 |
agttcatatgattgggaaggctgagaatttgggtagagtcc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18813 |
agttcatatgattgggaaggctgagaatttgggtagagtcc |
18853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University