View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8901_low_154 (Length: 245)

Name: NF8901_low_154
Description: NF8901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8901_low_154
NF8901_low_154
[»] chr5 (1 HSPs)
chr5 (1-236)||(38512178-38512413)


Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 38512413 - 38512178
Alignment:
1 ttgaaagtgtgaaatagttttacattgtcgtcaaatcatatctcttcattgagccacaccgctattttaaatcctaaaatatcttcacaaacatttgcag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38512413 ttgaaagtgtgaaatagttttacattgtcgtcaaatcatatctcttcattgagccacaccgctattttaaatcctaaaatatcttcacaaacatttgcag 38512314  T
101 agatatatctggatgacagcgtaaaactattttatctattgaactcttcacgaaattaggtataaacacttatgaagctgccactttcaccattgcgcac 200  Q
    ||||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
38512313 agatatatctggatgacagtgtaaaactattttatccattgaactcttcatgaaattaggtataaacacttatgaagctgccactttcaccattgcgcac 38512214  T
201 tactttatgtccatatgcacactacttgatgtccat 236  Q
    ||||||||||||||||||||||||||| ||||||||    
38512213 tactttatgtccatatgcacactactttatgtccat 38512178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University