View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8901_low_157 (Length: 243)
Name: NF8901_low_157
Description: NF8901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8901_low_157 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 39963685 - 39963454
Alignment:
| Q |
1 |
atgattttggaactcaatgcttcagatgatagaggaattgatgttgttagacagcagattcaagattttgccagcactcagagcttatcatttgggttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39963685 |
atgattttggaactcaatgcttcagatgatagaggaattgatgttgttagacagcagattcaagattttgccagcactcagagcttatcatttgggttgt |
39963586 |
T |
 |
| Q |
101 |
tttctcttcctattattttatctgtttataacagtttgtgtgcttgttactgtttttatgactgcataatagatagtgttttttagtttatatcattgcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39963585 |
tttctcttcctattattttatctgtttataacagtttgtgtgcttgttactgtttttatgactgcataatagatagtgttttttagtttatatcattgcc |
39963486 |
T |
 |
| Q |
201 |
ttatgtagttaatttgcatgtcaatttgatgt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39963485 |
ttatgtagttaatttgcatgtcaatttgatgt |
39963454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University