View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8901_low_163 (Length: 241)
Name: NF8901_low_163
Description: NF8901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8901_low_163 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 39963816 - 39964048
Alignment:
| Q |
1 |
acaaaaatcaacaaaaaataaataacacaccaaaggaacgataaaccctagaaatgaaaggggaagttagagagggaaagggagctacttgtgtcaacga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39963816 |
acaaaaatcaacaaaaaataaataacacaccaaaggaacgataaaccctagaaatgaaaggggaagttagagagggaaagggagttacttgtgtcaacga |
39963915 |
T |
 |
| Q |
101 |
tgtcgcggtgagctgcaacgtcgtcgagggattgaggacgatacttttcaacccatagcgaagctttgccaccgaaggaagggttaccggcggcaatgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39963916 |
tgtcgcggtgagctgcaacgtcgtcgagggattgaggacgatacttttcaacccatagcgaagctttgccaccgaaggaagggttaccggcggcaatgac |
39964015 |
T |
 |
| Q |
201 |
ggttttgcccttgtctgtaacgttgatgtccat |
233 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||| |
|
|
| T |
39964016 |
ggttttgcccttgtctgtgacgtcgatgtccat |
39964048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University