View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8901_low_165 (Length: 241)

Name: NF8901_low_165
Description: NF8901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8901_low_165
NF8901_low_165
[»] chr3 (1 HSPs)
chr3 (1-233)||(39963816-39964048)


Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 39963816 - 39964048
Alignment:
1 acaaaaatcaacaaaaaataaataacacaccaaaggaacgataaaccctagaaatgaaaggggaagttagagagggaaagggagctacttgtgtcaacga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
39963816 acaaaaatcaacaaaaaataaataacacaccaaaggaacgataaaccctagaaatgaaaggggaagttagagagggaaagggagttacttgtgtcaacga 39963915  T
101 tgtcgcggtgagctgcaacgtcgtcgagggattgaggacgatacttttcaacccatagcgaagctttgccaccgaaggaagggttaccggcggcaatgac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39963916 tgtcgcggtgagctgcaacgtcgtcgagggattgaggacgatacttttcaacccatagcgaagctttgccaccgaaggaagggttaccggcggcaatgac 39964015  T
201 ggttttgcccttgtctgtaacgttgatgtccat 233  Q
    |||||||||||||||||| |||| |||||||||    
39964016 ggttttgcccttgtctgtgacgtcgatgtccat 39964048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University