View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8901_low_170 (Length: 239)

Name: NF8901_low_170
Description: NF8901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8901_low_170
NF8901_low_170
[»] chr2 (4 HSPs)
chr2 (1-212)||(30830906-30831108)
chr2 (3-112)||(30836422-30836532)
chr2 (3-39)||(30854246-30854282)
chr2 (3-39)||(30841733-30841769)


Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 30831108 - 30830906
Alignment:
1 gtttcaccttgcttgcaaagattggggattctttcaggttttttctccctcctttaagcttcaatatcttaaatatatgacatatgattttgggtttctt 100  Q
    ||||||||||||||||||||||||||||||||||||||| |||| || ||| || |||||| ||||||||||||||||||||||||||||||||||||||    
30831108 gtttcaccttgcttgcaaagattggggattctttcaggtctttt-tctctc-ttcaagcttaaatatcttaaatatatgacatatgattttgggtttctt 30831011  T
101 gattaactttattcatttacttatatataaacaaaggttgttaacatttctagtccttccttcaaaaataaaagaatttagtccagtgatttgataacta 200  Q
    |||||||||||| |||||| |||||||  |||||||||||||||||||| |||||||||||||||||| ||     ||||||||||||||||||||||||    
30831010 gattaactttatacatttatttatata--aacaaaggttgttaacatttatagtccttccttcaaaaaaaa-----tttagtccagtgatttgataacta 30830918  T
201 catctaacattt 212  Q
    ||||||||||||    
30830917 catctaacattt 30830906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 3 - 112
Target Start/End: Complemental strand, 30836532 - 30836422
Alignment:
3 ttcaccttgcttgcaaagattggggattctttcaggttttttctccctcctttaagcttcaatatcttaaatatatgacat---atgattttgggtttct 99  Q
    ||||||||||||||||||||||||| ||||||||||| |||| || || ||| |||||||||||||| ||||||| |||||   ||||||||||||||||    
30836532 ttcaccttgcttgcaaagattggggtttctttcaggtctttt-tctct-cttcaagcttcaatatctcaaatataagacatctgatgattttgggtttct 30836435  T
100 tgattaactttat 112  Q
    | ||| |||||||    
30836434 taattgactttat 30836422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 3 - 39
Target Start/End: Complemental strand, 30854282 - 30854246
Alignment:
3 ttcaccttgcttgcaaagattggggattctttcaggt 39  Q
    |||||||||||||||||||||||||||||||||||||    
30854282 ttcaccttgcttgcaaagattggggattctttcaggt 30854246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 39
Target Start/End: Complemental strand, 30841769 - 30841733
Alignment:
3 ttcaccttgcttgcaaagattggggattctttcaggt 39  Q
    ||||||||||||||||||||||||||||||| |||||    
30841769 ttcaccttgcttgcaaagattggggattcttccaggt 30841733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University