View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8901_low_170 (Length: 239)
Name: NF8901_low_170
Description: NF8901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8901_low_170 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 30831108 - 30830906
Alignment:
| Q |
1 |
gtttcaccttgcttgcaaagattggggattctttcaggttttttctccctcctttaagcttcaatatcttaaatatatgacatatgattttgggtttctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| || ||| || |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30831108 |
gtttcaccttgcttgcaaagattggggattctttcaggtctttt-tctctc-ttcaagcttaaatatcttaaatatatgacatatgattttgggtttctt |
30831011 |
T |
 |
| Q |
101 |
gattaactttattcatttacttatatataaacaaaggttgttaacatttctagtccttccttcaaaaataaaagaatttagtccagtgatttgataacta |
200 |
Q |
| |
|
|||||||||||| |||||| ||||||| |||||||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
30831010 |
gattaactttatacatttatttatata--aacaaaggttgttaacatttatagtccttccttcaaaaaaaa-----tttagtccagtgatttgataacta |
30830918 |
T |
 |
| Q |
201 |
catctaacattt |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
30830917 |
catctaacattt |
30830906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 3 - 112
Target Start/End: Complemental strand, 30836532 - 30836422
Alignment:
| Q |
3 |
ttcaccttgcttgcaaagattggggattctttcaggttttttctccctcctttaagcttcaatatcttaaatatatgacat---atgattttgggtttct |
99 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||| || || ||| |||||||||||||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
30836532 |
ttcaccttgcttgcaaagattggggtttctttcaggtctttt-tctct-cttcaagcttcaatatctcaaatataagacatctgatgattttgggtttct |
30836435 |
T |
 |
| Q |
100 |
tgattaactttat |
112 |
Q |
| |
|
| ||| ||||||| |
|
|
| T |
30836434 |
taattgactttat |
30836422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 3 - 39
Target Start/End: Complemental strand, 30854282 - 30854246
Alignment:
| Q |
3 |
ttcaccttgcttgcaaagattggggattctttcaggt |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30854282 |
ttcaccttgcttgcaaagattggggattctttcaggt |
30854246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 39
Target Start/End: Complemental strand, 30841769 - 30841733
Alignment:
| Q |
3 |
ttcaccttgcttgcaaagattggggattctttcaggt |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30841769 |
ttcaccttgcttgcaaagattggggattcttccaggt |
30841733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University