View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8901_low_181 (Length: 220)
Name: NF8901_low_181
Description: NF8901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8901_low_181 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 5 - 211
Target Start/End: Complemental strand, 37071348 - 37071141
Alignment:
| Q |
5 |
ggagtagcagagagtctaagcataatgcttcttttccttgaacatatggtttttaacccgtggcaaaccaaacccaacttggatttggtttcctga-gga |
103 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37071348 |
ggagaagcagggagtctaagcataatgcttcttttccttgaacatatggtttttaacccgtggcaaaccaaacccaacttggatttggtttcctgaagga |
37071249 |
T |
 |
| Q |
104 |
gaaacatacccaagactgagtaacttgttcaagaaagttaaggtcccgtcgacattgtcaagaaggaaaacaaaggaaaaccttcttcgcactgcttttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37071248 |
gaaacatacccaagactgagtaacttgttcaagaaagttaaggtcccgtcgacattgtcaagaaggaaaacaaaggaaaaccttcttcgcactgcttttg |
37071149 |
T |
 |
| Q |
204 |
atgtccat |
211 |
Q |
| |
|
||| |||| |
|
|
| T |
37071148 |
atggccat |
37071141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University