View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8901_low_185 (Length: 215)
Name: NF8901_low_185
Description: NF8901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8901_low_185 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 38626776 - 38626982
Alignment:
| Q |
1 |
actcacttttaactaaagtcgactttacataatcaattcattaaaaatcaatttatgtcacattcagttagagacaaatacacaagcaacttctatgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38626776 |
actcacttttaactaaagtcgactttacataatcaattcattaaaaatcaatttatgtcacattcagttagagacaaatacacaagcaacttctatgcaa |
38626875 |
T |
|
| Q |
101 |
tactgctgttggaacttgcaatgacagcagacgagtcgggttaaacgaatcaaatacctgcaattgatgatcaatctccgtttccggatccctcatgtga |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38626876 |
tactactgttggaacttgcaatgacagcagacgagtcgggttaaacgaatcaaatacctgcaattgatgatcaatctccgtttccggatccctcatgtga |
38626975 |
T |
|
| Q |
201 |
tgtccat |
207 |
Q |
| |
|
|| |||| |
|
|
| T |
38626976 |
tggccat |
38626982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 60
Target Start/End: Complemental strand, 24364134 - 24364098
Alignment:
| Q |
24 |
tttacataatcaattcattaaaaatcaatttatgtca |
60 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
24364134 |
tttacataatcaattcattcaaaatcaatttttgtca |
24364098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University