View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_113 (Length: 313)
Name: NF8902A_low_113
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_113 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 19 - 313
Target Start/End: Complemental strand, 47285960 - 47285666
Alignment:
| Q |
19 |
catcagaaaccaaatcagataaacggtttagtgtaatgtcaccggcttctagacctagactctaccattcatctgcaattgtgttaagagatggaagagt |
118 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47285960 |
catcagaaaccaaatcagataaacgatttagtgtaatgtcaccagcttctagacctagactctaccattcatctgcaattgtgttaagagatggaagagt |
47285861 |
T |
 |
| Q |
119 |
tttagtaggtggtagtaatccacatgtaaattacaattttaccggagttgaatttccaaccgatttaagcttagaggcattttctccgccctatttgtcg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47285860 |
tttagtaggtggtagtaatccacatgtaaattacaattttaccggagttgaatttccaaccgatttaagcttagaggcattttctccgccctatttgtcg |
47285761 |
T |
 |
| Q |
219 |
ttggagtttgatctggtgcggccaacgatttggcatgtcaccaataaaattttagggtatagggtgttttattatgtgacatttacggtagctaa |
313 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47285760 |
ttggagtttgatctagtgcggccaacgatttggcatgtcaccaataaaattttagggtatagggtgttttattatgtgacatttacggtagctaa |
47285666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University